Gene Locus : human-LPL
Mode of mutation : Natural mutant
Disease : Hyperlipoproteinemia TypeI
Summary :
AAA Change :
Allelic Variant :
Risk Factor :
Inhibitor :
Structure :
Disease by interaction :
Interact Gene Locus :
Xenobiotic sensitivity :
Modification :
Torpedo_number : No torpedo number
Kinetic Parameter : No kinetic parameter
News : No news
Comment :
p.D308GfsX3 Asp308GlyfsTer3 c.899_921dup GGCTCTGCTTGAGTTGTAGAAAG
| Title : Rare and common variants in LPL and APOA5 in Thai subjects with severe hypertriglyceridemia: A resequencing approach - Khovidhunkit_2016_J.Clin.Lipidol_10_505 |
| Author(s) : Khovidhunkit W , Charoen S , Kiateprungvej A , Chartyingcharoen P , Muanpetch S , Plengpanich W |
| Ref : J Clin Lipidol , 10 :505 , 2016 |
| Abstract : |
| PubMedSearch : Khovidhunkit_2016_J.Clin.Lipidol_10_505 |
| PubMedID: 27206937 |
| Gene_locus related to this paper: human-LPL |