D308GfsX3_human-LPL

General

Gene Locus : human-LPL

Mode of mutation : Natural mutant

Disease : Hyperlipoproteinemia TypeI

Summary :

AAA Change :

Allelic Variant :

Risk Factor :

Inhibitor :

Structure :

Disease by interaction :

Interact Gene Locus :

Xenobiotic sensitivity :

Modification :

Torpedo_number : No torpedo number

Kinetic Parameter : No kinetic parameter

News : No news

Comment :
p.D308GfsX3 Asp308GlyfsTer3 c.899_921dup GGCTCTGCTTGAGTTGTAGAAAG

References (1)

Title : Rare and common variants in LPL and APOA5 in Thai subjects with severe hypertriglyceridemia: A resequencing approach - Khovidhunkit_2016_J.Clin.Lipidol_10_505
Author(s) : Khovidhunkit W , Charoen S , Kiateprungvej A , Chartyingcharoen P , Muanpetch S , Plengpanich W
Ref : J Clin Lipidol , 10 :505 , 2016
Abstract :
PubMedSearch : Khovidhunkit_2016_J.Clin.Lipidol_10_505
PubMedID: 27206937
Gene_locus related to this paper: human-LPL