N127DfsX23_human-ABHD12

General

Gene Locus : human-ABHD12

Mode of mutation : Natural mutant

Disease : PHARC Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract

Summary :

AAA Change :

Allelic Variant :

Risk Factor :

Inhibitor :

Structure :

Disease by interaction :

Interact Gene Locus :

Xenobiotic sensitivity :

Modification :

Torpedo_number : No torpedo number

Kinetic Parameter : No kinetic parameter

News : No news

Comment :
Deletion-insertion Homozygous p.Asn127Aspfs*23 c.379_385delTTATATACCATTGTAGTCTTACTGCTTTTGGTGAACACA exon3

References (1)

Title : A complex homozygous mutation in ABHD12 responsible for PHARC syndrome discovered with NGS and review of the literature - Lerat_2017_J.Peripher.Nerv.Syst_22_77
Author(s) : Lerat J , Cintas P , Beauvais-Dzugan H , Magdelaine C , Sturtz F , Lia AS
Ref : J Peripher Nerv Syst , 22 :77 , 2017
Abstract : Lerat_2017_J.Peripher.Nerv.Syst_22_77
ESTHER : Lerat_2017_J.Peripher.Nerv.Syst_22_77
PubMedSearch : Lerat_2017_J.Peripher.Nerv.Syst_22_77
PubMedID: 28448692
Gene_locus related to this paper: human-ABHD12