Gene Locus : human-ABHD12
Mode of mutation : Natural mutant
Disease : PHARC Polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract
Summary :
AAA Change :
Allelic Variant :
Risk Factor :
Inhibitor :
Structure :
Disease by interaction :
Interact Gene Locus :
Xenobiotic sensitivity :
Modification :
Torpedo_number : No torpedo number
Kinetic Parameter : No kinetic parameter
News : No news
Comment :
Deletion-insertion Homozygous p.Asn127Aspfs*23 c.379_385delTTATATACCATTGTAGTCTTACTGCTTTTGGTGAACACA exon3
Title : A complex homozygous mutation in ABHD12 responsible for PHARC syndrome discovered with NGS and review of the literature - Lerat_2017_J.Peripher.Nerv.Syst_22_77 |
Author(s) : Lerat J , Cintas P , Beauvais-Dzugan H , Magdelaine C , Sturtz F , Lia AS |
Ref : J Peripher Nerv Syst , 22 :77 , 2017 |
Abstract : Lerat_2017_J.Peripher.Nerv.Syst_22_77 |
ESTHER : Lerat_2017_J.Peripher.Nerv.Syst_22_77 |
PubMedSearch : Lerat_2017_J.Peripher.Nerv.Syst_22_77 |
PubMedID: 28448692 |
Gene_locus related to this paper: human-ABHD12 |